Sequence retrieval

Genome: Corynebacterium aurimucosum ATCC 700975
Start position: 206187
End position: 206222
Length: 36

DNA sequence
>NC_012590, from 206187 to 206222 (36 bp); Corynebacterium aurimucosum ATCC 700975 CCACTCCGCCGACCACTCCGCCGTCCACCCCGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 205134-206789	Sequence	cauri_0188 spaH surface-anchored fimbrial subunit