Sequence retrieval

Genome: Corynebacterium aurimucosum ATCC 700975
Start position: 2154704
End position: 2154733
Length: 30

DNA sequence
>NC_012590, from 2154704 to 2154733 (30 bp); Corynebacterium aurimucosum ATCC 700975 ACATAGTGCAACTTGGTGCAACTTGGTGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2154447-2154725	Sequence	cauri_1964 - hypothetical protein (Protein is coded in complementary strand; from 2154725 to 2154447)