Sequence retrieval

Genome: Corynebacterium aurimucosum ATCC 700975
Start position: 2069461
End position: 2069490
Length: 30

DNA sequence
>NC_012590, from 2069461 to 2069490 (30 bp); Corynebacterium aurimucosum ATCC 700975 GCTTCGCCTTCGACTTCGGCTTCGGCTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2068926-2072114	Sequence	cauri_1867 rne ribonuclease E (Protein is coded in complementary strand; from 2072114 to 2068926)