Sequence retrieval

Genome: Corynebacterium aurimucosum ATCC 700975
Start position: 1448739
End position: 1448768
Length: 30

DNA sequence
>NC_012590, from 1448739 to 1448768 (30 bp); Corynebacterium aurimucosum ATCC 700975 GAGCGGTGCCGCGAGGTGCCGAGCACTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1448007-1450298	Sequence	cauri_1306 secA2 preprotein translocase subunit SecA (Protein is coded in complementary strand; from 1450298 to 1448007)