Sequence retrieval

Genome: Corynebacterium aurimucosum ATCC 700975
Start position: 2496078
End position: 2496104
Length: 27

DNA sequence
>NC_012590, from 2496078 to 2496104 (27 bp); Corynebacterium aurimucosum ATCC 700975 CGACAACGCCGACAACGCTGACAACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2494568-2496676	Sequence	cauri_2289 ptsG PTS system, glucose-specific IIABC component