Sequence retrieval

Genome: Corynebacterium aurimucosum ATCC 700975
Start position: 1184353
End position: 1184379
Length: 27

DNA sequence
>NC_012590, from 1184353 to 1184379 (27 bp); Corynebacterium aurimucosum ATCC 700975 CCGCCGCAACCGCCGCAACCGTCGCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1183680-1185620	Sequence	cauri_1062 rho transcription termination factor Rho