Sequence retrieval

Genome: Corynebacterium aurimucosum ATCC 700975
Start position: 2340620
End position: 2340644
Length: 25

DNA sequence
>NC_012590, from 2340620 to 2340644 (25 bp); Corynebacterium aurimucosum ATCC 700975 CGGTGCGTTGCGGTCCGGAGCGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2339805-2341307	Sequence	cauri_2148 cat1 succinyl-CoA:Coenzyme A transferase (Protein is coded in complementary strand; from 2341307 to 2339805)