Sequence retrieval

Genome: Corynebacterium aurimucosum ATCC 700975
Start position: 437780
End position: 437803
Length: 24

DNA sequence
>NC_012590, from 437780 to 437803 (24 bp); Corynebacterium aurimucosum ATCC 700975 ATGGCGATGGCCATGGTGATGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 437208-439397	Sequence	cauri_0403 ptsS PTS system, sucrose-specific IIBC component