Sequence retrieval

Genome: Corynebacterium aurimucosum ATCC 700975
Start position: 2553517
End position: 2553540
Length: 24

DNA sequence
>NC_012590, from 2553517 to 2553540 (24 bp); Corynebacterium aurimucosum ATCC 700975 GCGCGCGCGAGCGCGCGGGCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2553102-2553518	Sequence	cauri_2336 trmFO methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase