Sequence retrieval

Genome: Corynebacterium aurimucosum ATCC 700975
Start position: 255283
End position: 255306
Length: 24

DNA sequence
>NC_012590, from 255283 to 255306 (24 bp); Corynebacterium aurimucosum ATCC 700975 TCGCGCACGCGCTGGCGCTCACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 254650-256131	Sequence	cauri_0232 cya adenylate cyclase (Protein is coded in complementary strand; from 256131 to 254650)