Sequence retrieval

Genome: Corynebacterium aurimucosum ATCC 700975
Start position: 2253299
End position: 2253322
Length: 24

DNA sequence
>NC_012590, from 2253299 to 2253322 (24 bp); Corynebacterium aurimucosum ATCC 700975 CAGCCCGCCAGCGCGCCAGCCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2252186-2253406	Sequence	cauri_2071 irp6A iron ABC transporter substrate-binding protein (Protein is coded in complementary strand; from 2253406 to 2252186)