Sequence retrieval

Genome: Corynebacterium aurimucosum ATCC 700975
Start position: 192840
End position: 192863
Length: 24

DNA sequence
>NC_012590, from 192840 to 192863 (24 bp); Corynebacterium aurimucosum ATCC 700975 CGCCGCAGCCGCCCCCGCCGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 191932-193587	Sequence	cauri_0181 - hypothetical protein (Protein is coded in complementary strand; from 193587 to 191932)