Sequence retrieval

Genome: Corynebacterium aurimucosum ATCC 700975
Start position: 1916300
End position: 1916323
Length: 24

DNA sequence
>NC_012590, from 1916300 to 1916323 (24 bp); Corynebacterium aurimucosum ATCC 700975 GTCGCGGCCGCGGTGGCGGTTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1915797-1917050	Sequence	cauri_1733 - permease of the major facilitator superfamily