Sequence retrieval

Genome: Corynebacterium aurimucosum ATCC 700975
Start position: 1778847
End position: 1778870
Length: 24

DNA sequence
>NC_012590, from 1778847 to 1778870 (24 bp); Corynebacterium aurimucosum ATCC 700975 CATCAGCTTCAGCATTAGCCTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1778348-1779094	Sequence	cauri_1606 - hypothetical protein (Protein is coded in complementary strand; from 1779094 to 1778348)