Sequence retrieval

Genome: Corynebacterium aurimucosum ATCC 700975
Start position: 1662201
End position: 1662224
Length: 24

DNA sequence
>NC_012590, from 1662201 to 1662224 (24 bp); Corynebacterium aurimucosum ATCC 700975 CTCTTCCTCATCTTCTTCATCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1661620-1662306	Sequence	cauri_1497 gluC glutamate ABC transport system, permease