Sequence retrieval

Genome: Corynebacterium aurimucosum ATCC 700975
Start position: 1421663
End position: 1421686
Length: 24

DNA sequence
>NC_012590, from 1421663 to 1421686 (24 bp); Corynebacterium aurimucosum ATCC 700975 TCGTCGTCGTTGTGGTCGTCATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1420889-1421734	Sequence	cauri_1280 msmF sn-glycerol-3-phosphate transport system permease ugpA