Sequence retrieval

Genome: Corynebacterium aurimucosum ATCC 700975
Start position: 1030045
End position: 1030068
Length: 24

DNA sequence
>NC_012590, from 1030045 to 1030068 (24 bp); Corynebacterium aurimucosum ATCC 700975 CGAAGCCGAGGCCGATGCCGAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1029627-1031201	Sequence	cauri_0935 - permease of the major facilitator superfamily (Protein is coded in complementary strand; from 1031201 to 1029627)