Sequence retrieval

Genome: Sulfolobus islandicus L.S.2.15
Start position: 773195
End position: 773224
Length: 30

DNA sequence
>NC_012589, from 773195 to 773224 (30 bp); Sulfolobus islandicus L.S.2.15 TGAAAGGGTAAGAATGGGTAAGAAATGGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 772783-773274	Sequence	LS215_0864 - DNA polymerase beta domain-containing protein region