Sequence retrieval

Genome: Sulfolobus islandicus L.S.2.15
Start position: 1986022
End position: 1986051
Length: 30

DNA sequence
>NC_012589, from 1986022 to 1986051 (30 bp); Sulfolobus islandicus L.S.2.15 AAAGAAATTAAATGGAATTATAAGAAATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1985268-1986059	Sequence	LS215_2186 - competence damage-inducible protein A
ORF... 1986040-1986810	Sequence	LS215_2187 - alpha/beta hydrolase fold protein (Protein is coded in complementary strand; from 1986810 to 1986040)