Sequence retrieval

Genome: Sulfolobus islandicus L.S.2.15
Start position: 1953256
End position: 1953285
Length: 30

DNA sequence
>NC_012589, from 1953256 to 1953285 (30 bp); Sulfolobus islandicus L.S.2.15 CTTAAATCTTCTTCAGTCTTCTTTAACCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1953229-1953858	Sequence	LS215_2152 - 6-phospho 3-hexuloisomerase (Protein is coded in complementary strand; from 1953858 to 1953229)