Sequence retrieval

Genome: Sulfolobus islandicus L.S.2.15
Start position: 1360501
End position: 1360527
Length: 27

DNA sequence
>NC_012589, from 1360501 to 1360527 (27 bp); Sulfolobus islandicus L.S.2.15 GGTTCCGGGGATTCCGGGGATTCCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1358716-1360653	Sequence	LS215_1446 - TrmB family transcriptional regulator (Protein is coded in complementary strand; from 1360653 to 1358716)