Sequence retrieval

Genome: Sulfolobus islandicus L.S.2.15
Start position: 395233
End position: 395256
Length: 24

DNA sequence
>NC_012589, from 395233 to 395256 (24 bp); Sulfolobus islandicus L.S.2.15 TTCTTCTTCATCCTCTTCTTCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 395018-395542	Sequence	LS215_0454 - hypothetical protein (Protein is coded in complementary strand; from 395542 to 395018)