Sequence retrieval

Genome: Sulfolobus islandicus L.S.2.15
Start position: 2707832
End position: 2707855
Length: 24

DNA sequence
>NC_012589, from 2707832 to 2707855 (24 bp); Sulfolobus islandicus L.S.2.15 TAAAAGTAAAAGTAAACGAAAAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2707700-2710051	Sequence	LS215_2935 - peptidase M1 membrane alanine aminopeptidase