Sequence retrieval

Genome: Sulfolobus islandicus L.S.2.15
Start position: 100925
End position: 100948
Length: 24

DNA sequence
>NC_012589, from 100925 to 100948 (24 bp); Sulfolobus islandicus L.S.2.15 TTTTACCATTTTTCCATTTGACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 100854-101888	Sequence	LS215_0114 - radical SAM protein (Protein is coded in complementary strand; from 101888 to 100854)