Sequence retrieval

Genome: Streptococcus pneumoniae 70585
Start position: 254765
End position: 254794
Length: 30

DNA sequence
>NC_012468, from 254765 to 254794 (30 bp); Streptococcus pneumoniae 70585 CATGTTTTCGCTTGTTTTAGCATTTTTACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 254649-255098	Sequence	SP70585_0301 - iron ABC transporter iron-binding protein (Protein is coded in complementary strand; from 255098 to 254649)