Sequence retrieval

Genome: Streptococcus pneumoniae 70585
Start position: 1603062
End position: 1603091
Length: 30

DNA sequence
>NC_012468, from 1603062 to 1603091 (30 bp); Streptococcus pneumoniae 70585 AACAATCGATTACCATCGATAGCAATCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1602750-1603202	Sequence	SP70585_1730 - hypothetical protein (Protein is coded in complementary strand; from 1603202 to 1602750)