Sequence retrieval

Genome: Streptococcus pneumoniae 70585
Start position: 1461787
End position: 1461813
Length: 27

DNA sequence
>NC_012468, from 1461787 to 1461813 (27 bp); Streptococcus pneumoniae 70585 GCCATCTTTGCCGTCTTTACCATCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1461152-1467109	Sequence	SP70585_1587 - G5 domain family (Protein is coded in complementary strand; from 1467109 to 1461152)