Sequence retrieval

Genome: Streptococcus pneumoniae 70585
Start position: 1338641
End position: 1338665
Length: 25

DNA sequence
>NC_012468, from 1338641 to 1338665 (25 bp); Streptococcus pneumoniae 70585 ATTTCATTTAAGTTCTTTTCCTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1337344-1338648	Sequence	SP70585_1441 - NOL1/NOP2/sun family protein (Protein is coded in complementary strand; from 1338648 to 1337344)
ORF... 1338649-1339422	Sequence	SP70585_1442 - inositol monophosphatase family protein (Protein is coded in complementary strand; from 1339422 to 1338649)