Sequence retrieval

Genome: Streptococcus pneumoniae 70585
Start position: 1287688
End position: 1287723
Length: 36

DNA sequence
>NC_012468, from 1287688 to 1287723 (36 bp); Streptococcus pneumoniae 70585 AGCAGCACCAGCATCAGCAGCATCAGCTGCAGCAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1287476-1287844	Sequence	SP70585_1392 rplL 50S ribosomal protein L7/L12 (Protein is coded in complementary strand; from 1287844 to 1287476)