Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 985734
End position: 985760
Length: 27

DNA sequence
>NC_012225, from 985734 to 985760 (27 bp); Brachyspira hyodysenteriae WA1 TTCTTTCTCTTTTTTCTCTTCATTCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 984973-985830	Sequence	BHWA1_00833 - aldo/keto reductase (Protein is coded in complementary strand; from 985830 to 984973)