Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 978713
End position: 978742
Length: 30

DNA sequence
>NC_012225, from 978713 to 978742 (30 bp); Brachyspira hyodysenteriae WA1 CAAATTAATAAAATTTAATATATATTAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 978728-978877	Sequence	BHWA1_00825 - hypothetical protein (Protein is coded in complementary strand; from 978877 to 978728)