Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 774843
End position: 774866
Length: 24

DNA sequence
>NC_012225, from 774843 to 774866 (24 bp); Brachyspira hyodysenteriae WA1 AAATAAAAATATAAACAAAAATAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 774346-774876	Sequence	BHWA1_00644 - hypothetical protein (Protein is coded in complementary strand; from 774876 to 774346)