Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 771840
End position: 771866
Length: 27

DNA sequence
>NC_012225, from 771840 to 771866 (27 bp); Brachyspira hyodysenteriae WA1 TATCTTTATTATTTTTATTAGCTTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 766271-773251	Sequence	BHWA1_00641 - hypothetical protein (Protein is coded in complementary strand; from 773251 to 766271)