Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 711580
End position: 711606
Length: 27

DNA sequence
>NC_012225, from 711580 to 711606 (27 bp); Brachyspira hyodysenteriae WA1 AATTCTAGCAATTCTACCAATTCTACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 710896-712146	Sequence	BHWA1_00592 - hypothetical protein (Protein is coded in complementary strand; from 712146 to 710896)