Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 409396
End position: 409419
Length: 24

DNA sequence
>NC_012225, from 409396 to 409419 (24 bp); Brachyspira hyodysenteriae WA1 AAATATAAATAGAACTATTAATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 408338-409513	Sequence	BHWA1_00368 - hypothetical protein (Protein is coded in complementary strand; from 409513 to 408338)