Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 400774
End position: 400800
Length: 27

DNA sequence
>NC_012225, from 400774 to 400800 (27 bp); Brachyspira hyodysenteriae WA1 ATAAAGATAATAAAAATAATAAAGAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 399835-401637	Sequence	BHWA1_00362 selB selenocysteine-specific translation elongation factor