Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 2988215
End position: 2988244
Length: 30

DNA sequence
>NC_012225, from 2988215 to 2988244 (30 bp); Brachyspira hyodysenteriae WA1 TTAATAATTCTTCATTATTCTTGGTAATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2987425-2988693	Sequence	BHWA1_02654 - hypothetical protein (Protein is coded in complementary strand; from 2988693 to 2987425)