Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 2958931
End position: 2958954
Length: 24

DNA sequence
>NC_012225, from 2958931 to 2958954 (24 bp); Brachyspira hyodysenteriae WA1 TTTTTCTTTTACTTCTTCTTTTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2957471-2959222	Sequence	BHWA1_02623 ptsA phosphoenolpyruvate-protein kinase (Protein is coded in complementary strand; from 2959222 to 2957471)