Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 2941364
End position: 2941390
Length: 27

DNA sequence
>NC_012225, from 2941364 to 2941390 (27 bp); Brachyspira hyodysenteriae WA1 AATCAAAATAATCAAAACGATCAAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2940762-2941667	Sequence	BHWA1_02610 batC aerotolerance-like exported protein BatC