Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 292394
End position: 292417
Length: 24

DNA sequence
>NC_012225, from 292394 to 292417 (24 bp); Brachyspira hyodysenteriae WA1 TTTTATCATTTTATTATTTTTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 292400-293521	Sequence	BHWA1_00257 - major facilitator superfamily MFS 1 (Protein is coded in complementary strand; from 293521 to 292400)