Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 2793669
End position: 2793692
Length: 24

DNA sequence
>NC_012225, from 2793669 to 2793692 (24 bp); Brachyspira hyodysenteriae WA1 AAATAAAAGTAAAGATAAAAATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2792626-2793675	Sequence	BHWA1_02481 lepB leader peptidase
ORF... 2793692-2795338	Sequence	BHWA1_02482 - hypothetical protein