Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 2777608
End position: 2777640
Length: 33

DNA sequence
>NC_012225, from 2777608 to 2777640 (33 bp); Brachyspira hyodysenteriae WA1 TATCTATATTTTATGAATATTTTATCTGAATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2777518-2777796	Sequence	BHWA1_02467 - hypothetical protein (Protein is coded in complementary strand; from 2777796 to 2777518)