Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 2761279
End position: 2761308
Length: 30

DNA sequence
>NC_012225, from 2761279 to 2761308 (30 bp); Brachyspira hyodysenteriae WA1 TATAAAATAATATAAAAGAATAAAGAATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2760974-2761378	Sequence	BHWA1_02449 - hypothetical protein (Protein is coded in complementary strand; from 2761378 to 2760974)