Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 2744932
End position: 2744961
Length: 30

DNA sequence
>NC_012225, from 2744932 to 2744961 (30 bp); Brachyspira hyodysenteriae WA1 AAGTGATATTAAGTGCTATTAATAGATATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2744206-2747952	Sequence	BHWA1_02433 purL phosphoribosylformylglycinamidine synthase