Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 2656100
End position: 2656124
Length: 25

DNA sequence
>NC_012225, from 2656100 to 2656124 (25 bp); Brachyspira hyodysenteriae WA1 AGTAAAGTACAGAAAAATAAAATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2655729-2656832	Sequence	BHWA1_02354 sagC streptolysin associated protein SagC