Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 2651644
End position: 2651667
Length: 24

DNA sequence
>NC_012225, from 2651644 to 2651667 (24 bp); Brachyspira hyodysenteriae WA1 ATATTTACATATTTTCATAATTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2651060-2651662	Sequence	BHWA1_02347 - hypothetical protein (Protein is coded in complementary strand; from 2651662 to 2651060)