Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 2597523
End position: 2597546
Length: 24

DNA sequence
>NC_012225, from 2597523 to 2597546 (24 bp); Brachyspira hyodysenteriae WA1 TCATTATAATTATTATTATTATTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2596860-2597645	Sequence	BHWA1_02292 - hypothetical protein (Protein is coded in complementary strand; from 2597645 to 2596860)