Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 2452603
End position: 2452632
Length: 30

DNA sequence
>NC_012225, from 2452603 to 2452632 (30 bp); Brachyspira hyodysenteriae WA1 TTAATTTTTTATAGTTTTTTTTAATAATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2452624-2452728	Sequence	BHWA1_02156 - hypothetical protein (Protein is coded in complementary strand; from 2452728 to 2452624)