Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 2381250
End position: 2381276
Length: 27

DNA sequence
>NC_012225, from 2381250 to 2381276 (27 bp); Brachyspira hyodysenteriae WA1 TGGAGGTGTTGGAGGAGTAGGAGGTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2380861-2383401	Sequence	BHWA1_02076 - hypothetical protein (Protein is coded in complementary strand; from 2383401 to 2380861)