Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 2315031
End position: 2315054
Length: 24

DNA sequence
>NC_012225, from 2315031 to 2315054 (24 bp); Brachyspira hyodysenteriae WA1 TTTATATTCATATTTATCTTTATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2314579-2315583	Sequence	BHWA1_02017 - TPR domain-containing protein (Protein is coded in complementary strand; from 2315583 to 2314579)